On November 11, 2015, Brazilian ministry of health reported an epidemic caused by Zika virus at the Northeast in the country. Many newborn babies presented a reduction in their crania, called microcephaly. Zika virus (ZIKV) is a mosquito-borne flavivirus related to yellow fever virus, dengue virus (DENV), and West Nile virus (WNV). It is a single-stranded positive RNA virus, that is closely related to the Spondweni virus and is transmitted by many Aedes spp. mosquitoes, including Ae. africanus, Ae. luteocephalus, Ae. hensilli, and Ae. aegypti. The vírus has been called Zika virus because the first isolation was made in April 1947 in the canopy of Zika forest, in 1947 the isolation occured from the serum of a pyrexial rhesus monkey. This abstract has the aim to show a method of indentification of serum Zika virus through electrochemical methods.

Electropolymerization of 4-aminobenzoic acid (4-ABA) over screen printed electrodes (SPs) was investigated for the development of electrochemical biosensing platforms. The electrogeneration of poly 4-ABA was carried out in a percloric acid solution using the cyclic voltammetry (CV) technique. In the CV studies, the SPs were modified by applying 10 consecutive potencial cycles, in the interval from -0.2 to 1.3V, at a scan rate of 50mV/s. The acidic solution (0.50 M HClO₄) of monomer was prepared in a concentration of 2.5mM. After the electropolymerization, the modified electrodes containing the polymeric films of poly(4-ABA), denoted as SPs/poly(4-ABA), were copiously washed with ultra-pure water and dried using a stream of N_2(g). The modified SPs were characterized in two diferent solutions: in HClO₄ solutions, and in the presence and absence of the ferrycianide/ferrocyanide redox couple solution. It used the CV and the electrochemical impedance spectroscopy techniques.

The poly(4-ABA) platforms were investigated for immobilization and detection of specific ssRNA of Zika virus. The specific ssRNA contains 20 nucleotides of the RNA of Zika virus, the sequence of the specific ssRNA is 5631 – 5665 (5’AATCAAAGCCTGAGCTCCAGGCTCTCTCTGGGACT3’). Metilene blue was used as an intercalator in the hybridization event between the ssRNA and the dsRNA was investigated using the Differential Pulse Voltammetry technique (VDP). The peak of the current reduction decreased (-125,73µA for -114,28µA) this decrease occurred using 50µM of ssRNA solution and the dsRNA solution was diluted for the factor of 1:10 in water.

The electrochemical impedance spectroscopy (EIS) proved that the modification of the surface of the SPs electrodes and the hybridization event between the ssRNA and the dsRNA occurred. The charge transfer resistance (RCT) was the parameter to prove the modification of the SPs electrodes surface with the poly(4-ABA). An increase in the RCT was observed. The clean SPs presented a RCT of 600 Ω, while the modified SPs presented a RCT of 18,3 MΩ.

To prove the hybridization event, solutions of dsRNA diluted in a factor of 1:10, 1:100 and 1:1000 were utilized. SPs/poly(4-ABA) more ssRNA presented a RCT of 1697Ω. After the hybridization event, the new platform presented a RCT of 269Ω. A decrease of 84.14% of RCT was observed. All the study using the EIS was carried out at the open circuit potential (OCP) obtained in the 0.10M KCl solution containing 5.0 mM of the K₄Fe(CN)₆/K₃Fe(CN)₆ redox couple. The frequency range was swept from 100kHz to 10mHz using single-sine mode. In order to ensure linearity to the impedance response, the RMS amplitude for the senoidal pertubation was 10 mV(p/p).

This result proved that the platform modified with poly(4-ABA) is very promising for the development of a biosensor to detect the Zika virus.